About   Help   FAQ
Serpinb3dem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Serpinb3dem2(IMPC)Tcp
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316213
Gene: Serpinb3d  Location: Chr1:107005893-107011210 bp, - strand  Genetic Position: Chr1, 50.34 cM
Alliance: Serpinb3dem2(IMPC)Tcp page
IMPC: Serpinb3d gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNA with spacer sequences of TTGTGTAAGGTTGTCACTGA and ATCATGCAGATTTTTCACTC targeting the 5' side and CCTGTAGTATTTCCACTGAT and TATAGCCTATCTAGTGGTGT targeting the 3' side of exon ENSMUSE00001035727 (exon 4) resulting in a 409-bp deletion of Chr1 from 107080521 to 107080929 (GRCm38). (J:200814)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Serpinb3d Mutation:  28 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory