Serpinb3dem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Serpinb3dem2(IMPC)Tcp |
| Name: |
serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316213 |
| Gene: |
Serpinb3d Location: Chr1:107005893-107011210 bp, - strand Genetic Position: Chr1, 50.34 cM
|
| Alliance: |
Serpinb3dem2(IMPC)Tcp page
|
| IMPC: |
Serpinb3d gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNA with spacer sequences of TTGTGTAAGGTTGTCACTGA and ATCATGCAGATTTTTCACTC targeting the 5' side and CCTGTAGTATTTCCACTGAT and TATAGCCTATCTAGTGGTGT targeting the 3' side of exon ENSMUSE00001035727 (exon 4) resulting in a 409-bp deletion of Chr1 from 107080521 to 107080929 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|