About   Help   FAQ
Sacsem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Sacsem2(IMPC)Tcp
Name: sacsin; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316211
Gene: Sacs  Location: Chr14:61375906-61478144 bp, + strand  Genetic Position: Chr14, 32.13 cM
Alliance: Sacsem2(IMPC)Tcp page
IMPC: Sacs gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0556 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AAGAAATAAGTTGCCCTCAT and ATACCTGATTGGATCAAGAT targeting the 5' side and CCAGTTGGTAGTATCCTTAG and CTTGCTCCCACTCTGAAGTG targeting the 3' side of exons ENSMUSE00000558006, ENSMUSE00000558005, and ENSMUSE00000558003 resulting in a 5734-bp deletion of Chr14 from 61179235 to 61184968 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sacs Mutation:  155 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory