Sacsem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sacsem2(IMPC)Tcp |
| Name: |
sacsin; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316211 |
| Gene: |
Sacs Location: Chr14:61375906-61478144 bp, + strand Genetic Position: Chr14, 32.13 cM
|
| Alliance: |
Sacsem2(IMPC)Tcp page
|
| IMPC: |
Sacs gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0556 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AAGAAATAAGTTGCCCTCAT and ATACCTGATTGGATCAAGAT targeting the 5' side and CCAGTTGGTAGTATCCTTAG and CTTGCTCCCACTCTGAAGTG targeting the 3' side of exons ENSMUSE00000558006, ENSMUSE00000558005, and ENSMUSE00000558003 resulting in a 5734-bp deletion of Chr14 from 61179235 to 61184968 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|