Sacs^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sacs^em2(IMPC)Tcp
• Name: sacsin; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316211
• Gene: Sacs Location: Chr14:61375906-61478144 bp, + strand Genetic Position: Chr14, 32.13 cM
• Alliance: Sacs^em2(IMPC)Tcp page
• IMPC: Sacs gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0556 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AAGAAATAAGTTGCCCTCAT and ATACCTGATTGGATCAAGAT targeting the 5' side and CCAGTTGGTAGTATCCTTAG and CTTGCTCCCACTCTGAAGTG targeting the 3' side of exons ENSMUSE00000558006, ENSMUSE00000558005, and ENSMUSE00000558003 resulting in a 5734-bp deletion of Chr14 from 61179235 to 61184968 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sacs Mutation: 155 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)