Rnf144a^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf144a^em2(IMPC)Tcp
• Name: ring finger protein 144A; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316210
• Gene: Rnf144a Location: Chr12:26356796-26465296 bp, - strand Genetic Position: Chr12, 9.69 cM, cytoband A3
• Alliance: Rnf144a^em2(IMPC)Tcp page
• IMPC: Rnf144a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0402, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATGTCCGTTTGGCAGAATAG, ATTAAGATAGAACGCATACC, TTGCACCTCTGGGATAATGT, and GCCTGGGTATGTGATCTATT. This resulted in a 777-bp del Chr12:26327093 to 26327869; p.(C46Rfs*23) (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rnf144a Mutation: 23 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)