About   Help   FAQ
Rnf144aem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf144aem2(IMPC)Tcp
Name: ring finger protein 144A; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316210
Gene: Rnf144a  Location: Chr12:26356796-26465296 bp, - strand  Genetic Position: Chr12, 9.69 cM, cytoband A3
Alliance: Rnf144aem2(IMPC)Tcp page
IMPC: Rnf144a gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele, from project TCPR0402, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATGTCCGTTTGGCAGAATAG, ATTAAGATAGAACGCATACC, TTGCACCTCTGGGATAATGT, and GCCTGGGTATGTGATCTATT. This resulted in a 777-bp del Chr12:26327093 to 26327869; p.(C46Rfs*23) (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rnf144a Mutation:  26 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory