Rnf135em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rnf135em2(IMPC)Tcp |
| Name: |
ring finger protein 135; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316209 |
| Gene: |
Rnf135 Location: Chr11:80074677-80090583 bp, + strand Genetic Position: Chr11, 47.59 cM, cytoband B5
|
| Alliance: |
Rnf135em2(IMPC)Tcp page
|
| IMPC: |
Rnf135 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0621 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTCTGACTTGTGTACTCAGG and TTGGAACAGGGCTCACACGT targeting the 5' side and GGCCATTCCCACCCAATCAG and TGATCCCTAATCCTAGTTTA targeting the 3' side of exon ENSMUSE00000108337 resulting in a 2,115-bp deletion of Chr11 from 80192852 to 80194966_insAAGGCA & a 390-bp deletion of Chr11 from 80195037 to 80195426 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|