About   Help   FAQ
Ptp4a1em3(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ptp4a1em3(IMPC)Tcp
Name: protein tyrosine phosphatase 4a1; endonuclease-mediated mutation 3, The Centre for Phenogenomics
MGI ID: MGI:6316206
Gene: Ptp4a1  Location: Chr1:30979384-30988838 bp, - strand  Genetic Position: Chr1, 11.47 cM
Alliance: Ptp4a1em3(IMPC)Tcp page
IMPC: Ptp4a1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0379 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of ATGCTACGTGTTATGTTGGG targeting the 5' side and AGTCCTGTCCTGCATGCAGG targeting the 3' side of OTTMUSE00000245667 and OTTMUSE00000245014. Two single-strand oligonucleotides were also injected to introduce loxP sites. Subsequent NHEJ-mediated repair resulted in c.106_329del. This mutation is predicted to cause a frameshift with the amino acid changes after residue 36 and early truncation 7 amino acids later (p.E36S*fs9). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ptp4a1 Mutation:  15 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory