Ptp4a1^em3(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptp4a1^em3(IMPC)Tcp
• Name: protein tyrosine phosphatase 4a1; endonuclease-mediated mutation 3, The Centre for Phenogenomics
• MGI ID: MGI:6316206
• Gene: Ptp4a1 Location: Chr1:30979384-30988838 bp, - strand Genetic Position: Chr1, 11.47 cM
• Alliance: Ptp4a1^em3(IMPC)Tcp page
• IMPC: Ptp4a1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0379 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of ATGCTACGTGTTATGTTGGG targeting the 5' side and AGTCCTGTCCTGCATGCAGG targeting the 3' side of OTTMUSE00000245667 and OTTMUSE00000245014. Two single-strand oligonucleotides were also injected to introduce loxP sites. Subsequent NHEJ-mediated repair resulted in c.106_329del. This mutation is predicted to cause a frameshift with the amino acid changes after residue 36 and early truncation 7 amino acids later (p.E36S*fs9). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ptp4a1 Mutation: 15 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)