Pebp1em3(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pebp1em3(IMPC)Tcp |
| Name: |
phosphatidylethanolamine binding protein 1; endonuclease-mediated mutation 3, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316205 |
| Gene: |
Pebp1 Location: Chr5:117420716-117425629 bp, - strand Genetic Position: Chr5, 56.88 cM
|
| Alliance: |
Pebp1em3(IMPC)Tcp page
|
| IMPC: |
Pebp1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele from project TCPR0388 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTTTAGTAGCGGCCATACTT and GAATTACCACTAATCTGCAT targeting the 5' side and GGCTATCTATCATCCGGACA and ATTCTGCCGTCCTTACAGTA targeting the 3' side of exons ENSMUSE00000292490 and ENSMUSE00000292484 resulting in a 813 bp deletion of Chr5 from 117285619 to 117286432 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 47 and early truncation 11 amino acids later (p.M47Sfs*13).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|