About   Help   FAQ
Pebp1em3(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Pebp1em3(IMPC)Tcp
Name: phosphatidylethanolamine binding protein 1; endonuclease-mediated mutation 3, The Centre for Phenogenomics
MGI ID: MGI:6316205
Gene: Pebp1  Location: Chr5:117420716-117425629 bp, - strand  Genetic Position: Chr5, 56.88 cM
Alliance: Pebp1em3(IMPC)Tcp page
IMPC: Pebp1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0388 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTTTAGTAGCGGCCATACTT and GAATTACCACTAATCTGCAT targeting the 5' side and GGCTATCTATCATCCGGACA and ATTCTGCCGTCCTTACAGTA targeting the 3' side of exons ENSMUSE00000292490 and ENSMUSE00000292484 resulting in a 813 bp deletion of Chr5 from 117285619 to 117286432 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 47 and early truncation 11 amino acids later (p.M47Sfs*13). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pebp1 Mutation:  18 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory