About   Help   FAQ
Nemp2em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Nemp2em2(IMPC)Tcp
Name: nuclear envelope integral membrane protein 2; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316203
Gene: Nemp2  Location: Chr1:52669862-52691078 bp, + strand  Genetic Position: Chr1, 26.99 cM
Alliance: Nemp2em2(IMPC)Tcp page
IMPC: Nemp2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0949 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of ATACCATCCTACACCAGACT and AGGAATGGATCAATCCACGC targeting the 5' side and TGATTCAACTTTAAAGACGG and GGAGAACAAGTCAGTGACGA targeting the 3' side of exon ENSMUSE00000602528 and ENSMUSE00000602527 resulting in a 838-bp deletion Chr1:52640706 to 52641543 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nemp2 Mutation:  11 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory