Nelfaem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nelfaem2(IMPC)Tcp |
| Name: |
negative elongation factor complex member A, Whsc2; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316202 |
| Gene: |
Nelfa Location: Chr5:34055263-34093615 bp, - strand Genetic Position: Chr5, 17.83 cM
|
| Alliance: |
Nelfaem2(IMPC)Tcp page
|
| IMPC: |
Nelfa gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0949 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of ATACCATCCTACACCAGACT and AGGAATGGATCAATCCACGC targeting the 5' side and TGATTCAACTTTAAAGACGG and GGAGAACAAGTCAGTGACGA targeting the 3' side of exon ENSMUSE00000602528 and ENSMUSE00000602527 resulting in a 838-bp deletion Chr1:52640706 to 52641543 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|