Nav2em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nav2em2(IMPC)Tcp |
| Name: |
neuron navigator 2; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316201 |
| Gene: |
Nav2 Location: Chr7:48608796-49259838 bp, + strand Genetic Position: Chr7, 31.23 cM
|
| Alliance: |
Nav2em2(IMPC)Tcp page
|
| IMPC: |
Nav2 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0782 was generated at The Centre for Phenogenomics by electroporating Cas9 RNPs with four guide RNAs with spacer sequences of CGGCCCTCCCTTGTCTAAAA and CGTCACCAGAGGCATAAATG targeting the 5' side and GGCGCTGCCGACCCATCTTC and CCAATCAGACCAGTGGCGCT targeting the 3' side of exon ENSMUSE00001316074 resulting in a 676-bp deletion of Chr7 from 49408593 to 49409268_insT; 1-bp insertion Chr7:49408480_insA (GCRm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|