Nans^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nans^em1(IMPC)Tcp
• Name: N-acetylneuraminic acid synthase (sialic acid synthase); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316200
• Gene: Nans Location: Chr4:46489319-46503439 bp, + strand Genetic Position: Chr4, 24.83 cM, cytoband B2
• Alliance: Nans^em1(IMPC)Tcp page
• IMPC: Nans gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences ATGGAAGCAGGTCGTATTAC, GAGGGAATACCTTTCACTAT, TAGTGTCGTGTGGAGACGTT, and TTCTTGTAGCAACTGATGGC that targeted exon(s) ENSMUSE00001229801.2 ENSMUSE00000178245.2 ENSMUSE00001239800.2. This resulted in deletion(s) of 9 bp (location: Chr4:46499554-46499562; GRCm39), 22 bp (location: Chr4:46498890-46498911; GRCm39), 578 bp (location: Chr4:46498918-46499495; GRCm39), and 1079 bp (location: Chr4:46499803-46500881; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nans Mutation: 20 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 4 reference(s)