About   Help   FAQ
Mvkem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mvkem2(IMPC)Tcp
Name: mevalonate kinase; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316199
Gene: Mvk  Location: Chr5:114582330-114598652 bp, + strand  Genetic Position: Chr5, 55.99 cM
Alliance: Mvkem2(IMPC)Tcp page
IMPC: Mvk gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0322 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ATAGGTGACTTAGCCTGACG and AGCCTCACCAACACGGGCAA resulting in a deletion of 666-bp from Chr5 from 114452050 to 114452715 witgh an insertion of a single T at the junction (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mvk Mutation:  19 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory