Mrgprx1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrgprx1^em2(IMPC)Tcp
• Name: MAS-related GPR, member X1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316198
• Gene: Mrgprx1 Location: Chr7:47670719-47677345 bp, - strand Genetic Position: Chr7, 31.09 cM
• Alliance: Mrgprx1^em2(IMPC)Tcp page
• IMPC: Mrgprx1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0434 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ACTACCCTGGTTGGACTGGC and GCAATCATCCCCTATATCTC targeting the 5' side and CCCTCTTAAGAACTCTTTTC and ATTGACAGTGCCAAGAAAGT targeting the 3' side of exon ENSMUSE00000531437 (exon 2) resulting in a 781-bp deletion of Chr7 from 48020896 to 48021676 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mrgprx1 Mutation: 17 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)