Mkrn3em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mkrn3em2(IMPC)Tcp |
| Name: |
makorin, ring finger protein, 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316196 |
| Gene: |
Mkrn3 Location: Chr7:62067341-62069887 bp, - strand Genetic Position: Chr7, 34.37 cM
|
| Alliance: |
Mkrn3em2(IMPC)Tcp page
|
| IMPC: |
Mkrn3 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0782 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GCGGCCGCGTGGGCCTCAAT and ATCGGGTCTGGCACCGCTCC targeting the 5' side and TTTCCCTCTCGCAACTGCAC and GAGCCAACGGTCATCAGAGA targeting the 3' side of exon ENSMUSE00000593055 resulting in a 1,434-bp deletion of Chr7 from 62418584 to 62420017 and a 8-bp deletion of Chr7 from 62418464 to 62418471 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|