About   Help   FAQ
Mcidasem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mcidasem1(IMPC)Tcp
Name: multiciliate differentiation and DNA synthesis associated cell cycle protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6316195
Gene: Mcidas  Location: Chr13:113130379-113136928 bp, + strand  Genetic Position: Chr13, 63.93 cM
Alliance: Mcidasem1(IMPC)Tcp page
IMPC: Mcidas gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0506 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CCATTCGAGAGGTAAGGATG and ACAGTAGGCTTGCCTTGGGC targeting the 5' side and GGGACAGACGTTAAGTAAAA and TTGCTTCAGGTTAGCTCAGC targeting the 3' side of the target region resulting in an 804-bp deletion of Chr13 from 112996485 to 112997288 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mcidas Mutation:  17 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory