Mcidas^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mcidas^em1(IMPC)Tcp
• Name: multiciliate differentiation and DNA synthesis associated cell cycle protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316195
• Gene: Mcidas Location: Chr13:113130379-113136928 bp, + strand Genetic Position: Chr13, 63.93 cM
• Alliance: Mcidas^em1(IMPC)Tcp page
• IMPC: Mcidas gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0506 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CCATTCGAGAGGTAAGGATG and ACAGTAGGCTTGCCTTGGGC targeting the 5' side and GGGACAGACGTTAAGTAAAA and TTGCTTCAGGTTAGCTCAGC targeting the 3' side of the target region resulting in an 804-bp deletion of Chr13 from 112996485 to 112997288 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mcidas Mutation: 17 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)