About   Help   FAQ
Klf8em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Klf8em2(IMPC)Tcp
Name: Kruppel-like transcription factor 8; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316194
Gene: Klf8  Location: ChrX:152020462-152179128 bp, + strand  Genetic Position: ChrX, 68.46 cM
Alliance: Klf8em2(IMPC)Tcp page
IMPC: Klf8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details: 

This allele from project TCPR861was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs single guide RNA(s) with spacer sequences of GTAATACCAGTTCTTAACAA and TCTCTTTAGACTACCAACGG targeting the 5' side and AGACGGCAAAAGTGCTGGAT and TTCACCGTTTGCAATTTTGA targeting the 3' side leading to a 737-bp deletion from ChrX:153382331 to 153383067; 1-bp deletion ChrX:153383168_delT resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:200814)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Klf8 Mutation:  65 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory