Klf8em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Klf8em2(IMPC)Tcp |
| Name: |
Kruppel-like transcription factor 8; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316194 |
| Gene: |
Klf8 Location: ChrX:152020462-152179128 bp, + strand Genetic Position: ChrX, 68.46 cM
|
| Alliance: |
Klf8em2(IMPC)Tcp page
|
| IMPC: |
Klf8 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR861was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs single guide RNA(s) with spacer sequences of GTAATACCAGTTCTTAACAA and TCTCTTTAGACTACCAACGG targeting the 5' side and AGACGGCAAAAGTGCTGGAT and TTCACCGTTTGCAATTTTGA targeting the 3' side leading to a 737-bp deletion from ChrX:153382331 to 153383067; 1-bp deletion ChrX:153383168_delT resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|