Jade2em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Jade2em2(IMPC)Tcp |
| Name: |
jade family PHD finger 2; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316193 |
| Gene: |
Jade2 Location: Chr11:51704282-51748480 bp, - strand Genetic Position: Chr11, 31.5 cM
|
| Alliance: |
Jade2em2(IMPC)Tcp page
|
| IMPC: |
Jade2 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR858 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNAs with spacer sequences of AGGACGGCTTCGTAGGCCAG and CCGGAAAACCTGCAGACATG targeting the 5' side and CTAGGAACGAATCTCAGAAC and GTTACTTACCCATGAGGCTT targeting the 3' side leading to a 1-bp deletion Chr11:51835394_delG, 271-bp deletion Chr11:51835470 to 51835740, and a 7-bp deletion Chr11:51835782 to 51835788 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|