Hsd17b4^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hsd17b4^em2(IMPC)Tcp
• Name: hydroxysteroid (17-beta) dehydrogenase 4; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316190
• Gene: Hsd17b4 Location: Chr18:50261268-50329336 bp, + strand Genetic Position: Chr18, 27.24 cM
• Alliance: Hsd17b4^em2(IMPC)Tcp page
• IMPC: Hsd17b4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0513 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence GAAAGAGGAGCATTAGTCAT [and a single-strand oligonucleotide encoding the changes c.105_112delAGTCATT to inactivate the PAM sequence and prevent re-cutting of the repaired allele in ENSMUSE00001289515]. Subsequent NHEJ-mediated repair introduced an indel comprised of a 5-bp deletion of Chr18 from 50130170 to 50130174 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Hsd17b4 Mutation: 51 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)