Hdgfl3em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Hdgfl3em2(IMPC)Tcp |
| Name: |
HDGF like 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316187 |
| Gene: |
Hdgfl3 Location: Chr7:81530999-81584221 bp, - strand Genetic Position: Chr7, 45.71 cM, cytoband D2
|
| Alliance: |
Hdgfl3em2(IMPC)Tcp page
|
| IMPC: |
Hdgfl3 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0726 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AGCGTGTAAGCCACCAACTC and ATGATATGTGCTTATCCCAC targeting the 5' side and CTGTGATGCAAACTATTACC and GATTCAATTAATGACTCAAG targeting the 3' side of exon ENSMUSE00001263741 resulting in a 353-bp deletion of Chr7 from 81900282 to 81900634 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|