Gpr141b^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr141b^em2(IMPC)Tcp
• Name: G protein-coupled receptor 141B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316184
• Gene: Gpr141b Location: Chr13:19911596-19917121 bp, - strand Genetic Position: Chr13, 7.03 cM
• Alliance: Gpr141b^em2(IMPC)Tcp page
• IMPC: Gpr141b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC resulting in a 744 bp deletion of Chr13 from 19729111 to 19729854 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 10 and early truncation 39 amino acids later (p.S10Vfs*41). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gpr141b Mutation: 20 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)