About   Help   FAQ
Gpr141bem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr141bem2(IMPC)Tcp
Name: G protein-coupled receptor 141B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316184
Gene: Gpr141b  Location: Chr13:19911596-19917121 bp, - strand  Genetic Position: Chr13, 7.03 cM
Alliance: Gpr141bem2(IMPC)Tcp page
IMPC: Gpr141b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC resulting in a 744 bp deletion of Chr13 from 19729111 to 19729854 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 10 and early truncation 39 amino acids later (p.S10Vfs*41). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gpr141b Mutation:  20 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory