Golph3^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Golph3^em2(IMPC)Tcp
• Name: golgi phosphoprotein 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316183
• Gene: Golph3 Location: Chr15:12321536-12351677 bp, + strand Genetic Position: Chr15, 5.9 cM
• Alliance: Golph3^em2(IMPC)Tcp page
• IMPC: Golph3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR941 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of TGGTACTTACCCAAGTCAAT and GGAAGGGTCGTCCTTTTACC targeting the 5' side and ACCGTTTACTCTGTTTAGAG and CGTTATGTTTTGTACACCAG targeting the 3' side leading to a 4,022-bp deletion from Chr15:12339468 to 12343489 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Golph3 Mutation: 14 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)