Golph3em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Golph3em2(IMPC)Tcp |
| Name: |
golgi phosphoprotein 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316183 |
| Gene: |
Golph3 Location: Chr15:12321536-12351677 bp, + strand Genetic Position: Chr15, 5.9 cM
|
| Alliance: |
Golph3em2(IMPC)Tcp page
|
| IMPC: |
Golph3 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR941 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of TGGTACTTACCCAAGTCAAT and GGAAGGGTCGTCCTTTTACC targeting the 5' side and ACCGTTTACTCTGTTTAGAG and CGTTATGTTTTGTACACCAG targeting the 3' side leading to a 4,022-bp deletion from Chr15:12339468 to 12343489 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|