About   Help   FAQ
Golph3em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Golph3em2(IMPC)Tcp
Name: golgi phosphoprotein 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316183
Gene: Golph3  Location: Chr15:12321536-12351677 bp, + strand  Genetic Position: Chr15, 5.9 cM
Alliance: Golph3em2(IMPC)Tcp page
IMPC: Golph3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR941 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of TGGTACTTACCCAAGTCAAT and GGAAGGGTCGTCCTTTTACC targeting the 5' side and ACCGTTTACTCTGTTTAGAG and CGTTATGTTTTGTACACCAG targeting the 3' side leading to a 4,022-bp deletion from Chr15:12339468 to 12343489 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Golph3 Mutation:  15 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory