About   Help   FAQ
Gm4922em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gm4922em2(IMPC)Tcp
Name: predicted gene 4922; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316182
Gene: Gm4922  Location: Chr10:18655475-18662541 bp, - strand  Genetic Position: Chr10, 7.92 cM
Alliance: Gm4922em2(IMPC)Tcp page
IMPC: Gm4922 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0417 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTGAGCTCGGTCTTGGTTTG and CTTCAGGACGGTGTACTGCC targeting the 5' side and CAGCTCAGTGTCCTAATCAC and ATGTCCGTTTGGCAGAATAG targeting the 3' side of exon ENSMUSE00000403934 resulting in a 1,705-bp deletion of Chr10 from 18783188 to 18784892 deleting majority of ENSMUSE00000403934 including splice donor (single exon ORF) and a 2-bp deletion Chr10 from 18783160 to 18783161 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gm4922 Mutation:  29 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory