Gm4922^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm4922^em2(IMPC)Tcp
• Name: predicted gene 4922; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316182
• Gene: Gm4922 Location: Chr10:18655475-18662541 bp, - strand Genetic Position: Chr10, 7.92 cM
• Alliance: Gm4922^em2(IMPC)Tcp page
• IMPC: Gm4922 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0417 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTGAGCTCGGTCTTGGTTTG and CTTCAGGACGGTGTACTGCC targeting the 5' side and CAGCTCAGTGTCCTAATCAC and ATGTCCGTTTGGCAGAATAG targeting the 3' side of exon ENSMUSE00000403934 resulting in a 1,705-bp deletion of Chr10 from 18783188 to 18784892 deleting majority of ENSMUSE00000403934 including splice donor (single exon ORF) and a 2-bp deletion Chr10 from 18783160 to 18783161 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gm4922 Mutation: 29 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)