G2e3em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
G2e3em2(IMPC)Tcp |
| Name: |
G2/M-phase specific E3 ubiquitin ligase; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316181 |
| Gene: |
G2e3 Location: Chr12:51395013-51423769 bp, + strand Genetic Position: Chr12, 22.11 cM
|
| Alliance: |
G2e3em2(IMPC)Tcp page
|
| IMPC: |
G2e3 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0802 was generated at The Centre for Phenogenomics by electroporating Cas9 RNP complexes with four guide RNAs with spacer sequences of TCTATTTACCCTCGTACCCA and GTACAGGATGCTAGACTATA targeting the 5' side and AGTGTAATAGGCTCCAAGAG and ACTCACTGAAAACAGTCCGG targeting the 3' side of exon ENSMUSE00000312307 resulting in a 703-bp deletion of Chr12 from 51356753 to 51357455 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|