About   Help   FAQ
Fblim1em3(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Fblim1em3(IMPC)Tcp
Name: filamin binding LIM protein 1; endonuclease-mediated mutation 3, The Centre for Phenogenomics
MGI ID: MGI:6316179
Gene: Fblim1  Location: Chr4:141303373-141333351 bp, - strand  Genetic Position: Chr4, 74.64 cM, cytoband E1
Alliance: Fblim1em3(IMPC)Tcp page
IMPC: Fblim1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0328 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence CTTGTGAAGCCAGACGCGCT and a single-strand oligonucleotide encoding a point mutation. This allele was repaired by NHEJ resulting in a 8-bp deletion (GCGTCTGG) and 1-bp insertion at Chr4:141595354-141595361_insC (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fblim1 Mutation:  82 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory