Fblim1^em3(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fblim1^em3(IMPC)Tcp
• Name: filamin binding LIM protein 1; endonuclease-mediated mutation 3, The Centre for Phenogenomics
• MGI ID: MGI:6316179
• Gene: Fblim1 Location: Chr4:141303373-141333351 bp, - strand Genetic Position: Chr4, 74.64 cM, cytoband E1
• Alliance: Fblim1^em3(IMPC)Tcp page
• IMPC: Fblim1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele produced from project TCPR0328 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence CTTGTGAAGCCAGACGCGCT and a single-strand oligonucleotide encoding a point mutation. This allele was repaired by NHEJ resulting in a 8-bp deletion (GCGTCTGG) and 1-bp insertion at Chr4:141595354-141595361_insC (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fblim1 Mutation: 82 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)