About   Help   FAQ
Fhip1bem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Fhip1bem2(IMPC)Tcp
Name: FHF complex subunit HOOK interacting protein 1B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316177
Gene: Fhip1b  Location: Chr7:105020418-105049261 bp, - strand  Genetic Position: Chr7, 55.84 cM
Alliance: Fhip1bem2(IMPC)Tcp page
IMPC: Fhip1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR907 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of GCCAACCTCTGTTGCGGCAT and GTCCATCGAGAAGGCACCCT targeting the 5' side and GATTGCGAGTACCGCCTACC and GGCAACGAGCGTGTCAAGGA targeting the 3' side leading to the a 1,272-bp deletion from Chr7:105388318 to 105389589 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fhip1b Mutation:  41 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory