Fhip1bem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Fhip1bem2(IMPC)Tcp |
| Name: |
FHF complex subunit HOOK interacting protein 1B; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316177 |
| Gene: |
Fhip1b Location: Chr7:105020418-105049261 bp, - strand Genetic Position: Chr7, 55.84 cM
|
| Alliance: |
Fhip1bem2(IMPC)Tcp page
|
| IMPC: |
Fhip1b gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR907 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of GCCAACCTCTGTTGCGGCAT and GTCCATCGAGAAGGCACCCT targeting the 5' side and GATTGCGAGTACCGCCTACC and GGCAACGAGCGTGTCAAGGA targeting the 3' side leading to the a 1,272-bp deletion from Chr7:105388318 to 105389589 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|