About   Help   FAQ
Enamem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Enamem2(IMPC)Tcp
Name: enamelin; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316175
Gene: Enam  Location: Chr5:88635834-88653908 bp, + strand  Genetic Position: Chr5, 43.66 cM, cytoband E2
Alliance: Enamem2(IMPC)Tcp page
IMPC: Enam gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0357 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GTAGGATTGTTCCCAGCGTT and TCCTGCATAATTAACCCCGG resulting in a 6-bp deletion at Chr5:88501701-88501706 (p.N357 & p.A358) and an indel at Chr5:88502020_delGinsACAGTA (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Enam Mutation:  71 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory