Dusp16^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dusp16^em2(IMPC)Tcp
• Name: dual specificity phosphatase 16; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316174
• Gene: Dusp16 Location: Chr6:134692431-134769588 bp, - strand Genetic Position: Chr6, 65.77 cM
• Alliance: Dusp16^em2(IMPC)Tcp page
• IMPC: Dusp16 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0801 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GCTTGTATGCTACTTTTCAA and CTGTTTGAAGACCCCTTGGC targeting the 5' side and ACAGCTTTCGATTGATAGAA and GTGGACTTTCACACCTGACT targeting the 3' side of exon ENSMUSE00001282667 (exon 3) resulting in a 872-bp deletion of Chr6 from 134758324 to 134759195_insG (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dusp16 Mutation: 61 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)