About   Help   FAQ
Colec10em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Colec10em1(IMPC)Tcp
Name: collectin sub-family member 10; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6316172
Gene: Colec10  Location: Chr15:54274170-54329754 bp, + strand  Genetic Position: Chr15, 21.15 cM
Alliance: Colec10em1(IMPC)Tcp page
IMPC: Colec10 gene page
Mutation
origin
Strain of Origin:  CD-1
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0371 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of GCAAATTCAAGGAACAATAT targeting the 5' side and GCTTTTGCTCAAATGCCATA targeting the 3' side of exon ENSMUSE00000352964 resulting in an 1108-bp deletion of Chr15 from 54461600 to 54462707 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Colec10 Mutation:  30 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory