Colec10^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Colec10^em1(IMPC)Tcp
• Name: collectin sub-family member 10; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316172
• Gene: Colec10 Location: Chr15:54274170-54329754 bp, + strand Genetic Position: Chr15, 21.15 cM
• Alliance: Colec10^em1(IMPC)Tcp page
• IMPC: Colec10 gene page

Mutation origin

• Strain of Origin: CD-1
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0371 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of GCAAATTCAAGGAACAATAT targeting the 5' side and GCTTTTGCTCAAATGCCATA targeting the 3' side of exon ENSMUSE00000352964 resulting in an 1108-bp deletion of Chr15 from 54461600 to 54462707 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Colec10 Mutation: 27 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)