Chst14^em6(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chst14^em6(IMPC)Tcp
• Name: carbohydrate sulfotransferase 14; endonuclease-mediated mutation 6, The Centre for Phenogenomics
• MGI ID: MGI:6316171
• Gene: Chst14 Location: Chr2:118756978-118759066 bp, + strand Genetic Position: Chr2, 59.73 cM, cytoband E5
• Alliance: Chst14^em6(IMPC)Tcp page
• IMPC: Chst14 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using D10A and guides with spacer sequences CAGGGTCTCCGCGCTTTTCG and CCTGGGCCGCACGCCAAGGC that targeted exon(s) ENSMUSE00000642278.6 ENSMUSE00000685622.2. This resulted in deletion(s) of 11 bp (location: Chr2:118757175-118757185; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Chst14 Mutation: 19 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 2 reference(s)