Ccnb1ip1em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ccnb1ip1em2(IMPC)Tcp |
| Name: |
cyclin B1 interacting protein 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316167 |
| Gene: |
Ccnb1ip1 Location: Chr14:51026706-51033185 bp, - strand Genetic Position: Chr14, 26.25 cM
|
| Alliance: |
Ccnb1ip1em2(IMPC)Tcp page
|
| IMPC: |
Ccnb1ip1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0410 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCAATACCTTGGTCTTTCCA and TTTGCAATTATCGGAAGTGT targeting the 5' side and ATCCCGCAGTCTGGAGTCTT and ACCACAGTAAACTGAGCTGT targeting the 3' side of exons ENSMUSE00000617176 and ENSMUSE00000617175 resulting in a 2,141 bp deletion of Chr14 from 50791871 to 50794011 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|