Bdp1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bdp1^em2(IMPC)Tcp
• Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316165
• Gene: Bdp1 Location: Chr13:100154502-100240578 bp, - strand Genetic Position: Chr13, 52.92 cM
• Alliance: Bdp1^em2(IMPC)Tcp page
• IMPC: Bdp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR880 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) with spacer sequences of GATACATTGGAGAGGTGAAG and GCCAGGCATAATGAAATACA targeting the 5' side and TAAAATGGAACCTGCCACGT and CTGCCAACTATTCACTTAAA targeting the 3' side resulting in a 1,610-bp deletion Chr13:100092103 to 100093712 &2-bp deletion Chr13:100091998 to 100091997_delTT (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Bdp1 Mutation: 87 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)