About   Help   FAQ
Baz2aem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Baz2aem2(IMPC)Tcp
Name: bromodomain adjacent to zinc finger domain, 2A; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316164
Gene: Baz2a  Location: Chr10:127927453-127965172 bp, + strand  Genetic Position: Chr10, 76.4 cM, cytoband D3
Alliance: Baz2aem2(IMPC)Tcp page
IMPC: Baz2a gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0415 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and single guide RNA(s) with spacer sequences of AGCACACAAGCTTGATAAAC and GTGTAGGACTGTCTGCATGC targeting the 5' side and GTTCTACTCATGCCTTCCAA and ATAGTAATGGCCAAACGAGA targeting the 3' side of exons ENSMUSE00000272786, ENSMUSE00000272778, and ENSMUSE00000471272 (exons 9-11) resulting in a 1 bp insT at Chr10:128115888, and a 1148 bp deletion of Chr10 from 128115921 to 128117068 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Baz2a Mutation:  132 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory