Baz2a^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Baz2a^em2(IMPC)Tcp
• Name: bromodomain adjacent to zinc finger domain, 2A; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316164
• Gene: Baz2a Location: Chr10:127927453-127965172 bp, + strand Genetic Position: Chr10, 76.4 cM, cytoband D3
• Alliance: Baz2a^em2(IMPC)Tcp page
• IMPC: Baz2a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0415 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and single guide RNA(s) with spacer sequences of AGCACACAAGCTTGATAAAC and GTGTAGGACTGTCTGCATGC targeting the 5' side and GTTCTACTCATGCCTTCCAA and ATAGTAATGGCCAAACGAGA targeting the 3' side of exons ENSMUSE00000272786, ENSMUSE00000272778, and ENSMUSE00000471272 (exons 9-11) resulting in a 1 bp insT at Chr10:128115888, and a 1148 bp deletion of Chr10 from 128115921 to 128117068 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Baz2a Mutation: 132 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)