Aspg^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aspg^em2(IMPC)Tcp
• Name: asparaginase; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316163
• Gene: Aspg Location: Chr12:112073113-112093993 bp, + strand Genetic Position: Chr12, 61.14 cM
• Alliance: Aspg^em2(IMPC)Tcp page
• IMPC: Aspg gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0619 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TAGGCGGGACTGTGGCACCC and CGATCTCCAACTAGGATGTG targeting the 5' side and GCCCAAACCATAGAGGTAGA and CTGGGCAAGTGAGTAACTAT targeting the 3' side of exon ENSMUSE00000396327 resulting in a 393-bp deletion of Chr12 from 112112431 to 112112823 and a 468-bp deletion of Chr12 from 112112828 to 112113295_insA (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Aspg Mutation: 39 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)