Ap2s1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ap2s1^em2(IMPC)Tcp
• Name: adaptor-related protein complex 2, sigma 1 subunit; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316162
• Gene: Ap2s1 Location: Chr7:16472369-16483215 bp, + strand Genetic Position: Chr7, 9.15 cM
• Alliance: Ap2s1^em2(IMPC)Tcp page
• IMPC: Ap2s1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project TCPR0357 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequence of GCAAGACGCGCCTGGCCAAG targeting the 5' side and GATCGAGGAGGTGCACGCCG targeting the 3' side of exon ENSMUSE00000286435. This mutation is predicted to cause a frameshift with the amino acid changes after residue 20 and early truncation 46 amino acids later (p.Y20S*fs48). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ap2s1 Mutation: 15 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)