About   Help   FAQ
Ap2s1em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ap2s1em2(IMPC)Tcp
Name: adaptor-related protein complex 2, sigma 1 subunit; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316162
Gene: Ap2s1  Location: Chr7:16472369-16483215 bp, + strand  Genetic Position: Chr7, 9.15 cM
Alliance: Ap2s1em2(IMPC)Tcp page
IMPC: Ap2s1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project TCPR0357 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequence of GCAAGACGCGCCTGGCCAAG targeting the 5' side and GATCGAGGAGGTGCACGCCG targeting the 3' side of exon ENSMUSE00000286435. This mutation is predicted to cause a frameshift with the amino acid changes after residue 20 and early truncation 46 amino acids later (p.Y20S*fs48). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ap2s1 Mutation:  15 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory