About   Help   FAQ
Alg6em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Alg6em2(IMPC)Tcp
Name: ALG6 alpha-1,3-glucosyltransferase; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316161
Gene: Alg6  Location: Chr4:99603901-99651697 bp, + strand  Genetic Position: Chr4, 45.71 cM
Alliance: Alg6em2(IMPC)Tcp page
IMPC: Alg6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project TCPR0837 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with 4 guide RNAs with spacer sequences of GGACATTTGGAGTATCCAGA and GTGCTCTTGCCGCTTTGAGT targeting the 5' side GGTCTTATTCTTATCGACTA and CCTAGATCATAATATGTAAC targeting the 3' side of exons ENSMUSE00001275430 and ENSMUSE00001257593 resulting in a 1431-bp deletion Chr4: 99740974 to 99742404; 20-bp deletion Chr4:99740914 to 99740932_insCCA; Chr4:99742454_insA (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Alg6 Mutation:  28 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory