About   Help   FAQ
Adamtsl3em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Adamtsl3em2(IMPC)Tcp
Name: ADAMTS-like 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316160
Synonyms: Adamts13em2(IMPC)Tcp
Gene: Adamtsl3  Location: Chr7:81984902-82263658 bp, + strand  Genetic Position: Chr7, 47.18 cM
Alliance: Adamtsl3em2(IMPC)Tcp page
IMPC: Adamtsl3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project TCPR837 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNA(s) with spacer sequences of CACTTTAATCTAAGGCAAGA and GATTGCTGTAGGGCCATTGC targeting the 5' side and GTGATACCTACAGCATTCGG and GGTAGGACTTGTCTAAACAC targeting the 3' side of exon ENSMUSE00000591449 resulting in a 218-bp deletion Chr7:82575906 to 82576123_insTGTGGTGCA and 21-bp deletion Chr7:82576215 to 82576235_insA (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Adamtsl3 Mutation:  87 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory