Dydc2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dydc2em1(IMPC)J |
| Name: |
DPY30 domain containing 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6314223 |
| Gene: |
Dydc2 Location: Chr14:40771074-40791165 bp, - strand Genetic Position: Chr14, 22.36 cM, cytoband C1
|
| Alliance: |
Dydc2em1(IMPC)J page
|
| IMPC: |
Dydc2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTCAGCCTCTATCAGCCAG and AACTCGCTTTAGGAAAAGAA, which resulted in a 970 bp deletion beginning at Chromosome 14 position 41,061,848 bp and ending after 41,062,817 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120891 and ENSMUSE00000120893 (exons 2 and 3) and 691 bp of flanking intronic sequence including the translation start, splice acceptor and donor and is predicted to generate a null allele.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|