About   Help   FAQ
Ccdc15em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc15em1(IMPC)J
Name: coiled-coil domain containing 15; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6314215
Gene: Ccdc15  Location: Chr9:37187131-37259728 bp, - strand  Genetic Position: Chr9, 20.74 cM
Alliance: Ccdc15em1(IMPC)J page
IMPC: Ccdc15 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGACTGAAGTAACCAGTTA and AAAGTTTCGTTGTAAATATA, which resulted in a 13,775 bp deletion beginning at Chromosome 9 position 37,302,836 bp and ending after 37,316,610 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000344794-ENSMUSE00000335669 (exons 6-12) and 12,426 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 233 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc15 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory