Dnajb14em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Dnajb14em1(IMPC)J |
Name: |
DnaJ heat shock protein family (Hsp40) member B14; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6314206 |
Gene: |
Dnajb14 Location: Chr3:137572801-137619350 bp, + strand Genetic Position: Chr3, 63.94 cM
|
Alliance: |
Dnajb14em1(IMPC)J page
|
IMPC: |
Dnajb14 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCTGGAGAGACTAAACA and ATATAGCACAGTTTAATAGA, which resulted in a 396 bp deletion beginning at Chromosome 3 position 137,885,162 bp and ending after 137,885,557 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001225953 (exon 2) and 224 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 45. There is an 8 bp insertion (TTCATAGC) at the deletion site and a single bp insertion (T) 11 bp before the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|