Tmem147^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem147^em1(IMPC)J
• Name: transmembrane protein 147; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6313402
• Gene: Tmem147 Location: Chr7:30427126-30428959 bp, - strand Genetic Position: Chr7, 19.23 cM, cytoband A3
• Alliance: Tmem147^em1(IMPC)J page
• IMPC: Tmem147 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTTCCCCATGAGAACCTGG and AAAAGTCTAGAAGTTCACGG, which resulted in a 1369 bp deletion beginning at Chromosome 7 position 30,727,564 bp and ending after 30,728,932 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200571-ENSMUSE00001376528 (exons 3-7) and 766 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem147 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)