Gm75297^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm75297^em1(IMPC)Mbp
• Name: predicted gene, 75297; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6313352
• Gene: Gm75297 Location: Chr2:98493172-98497678 bp, - strand Genetic Position: Chr2, 53.07 cM
• Alliance: Gm75297^em1(IMPC)Mbp page
• IMPC: Gm75297 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting and 2 guide sequences AAATCATCTGTTTCCAAAGTAGG, CCAACGTATGTGTTTTTTTTGTG, which resulted in a Whole-gene deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gm75297 Mutation: 0 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)