About   Help   FAQ
Inpp5dem1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Inpp5dem1(IMPC)Bay
Name: inositol polyphosphate-5-phosphatase D; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6306626
Gene: Inpp5d  Location: Chr1:87548034-87648229 bp, + strand  Genetic Position: Chr1, 44.44 cM, cytoband C5
Alliance: Inpp5dem1(IMPC)Bay page
IMPC: Inpp5d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences CCACTGGCTGCGGGATGTGAGGC, ACTGGATTAGACAGTCTTGCTGG, GTTGCGGTTACTGCAACCTGAGG, GCACCTTTGCAAAGGGCTCCTGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Inpp5d Mutation:  94 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory