Rr70^em1Rsnk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr70^em1Rsnk
• Name: regulatory region 70; endonuclease-mediated mutation 1, James Resnick
• MGI ID: MGI:6306477
• Synonyms: AS^Term
• Gene: Rr70 Location: unknown Genetic Position: Chr7, Syntenic
• Alliance: Rr70^em1Rsnk page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: CRISPR-targeting, using sgRNAS targeting TGGCAGGATTAGCAGTTCAG and GGACTAGAGACTCTTCCACT, inserted a floxed rabbit beta-globin transcriptional terminator sequence 28.6 kb downstream of upstream exon U1 and 14.3 kb upstream of the Snrpn promoter at the Angelman syndrome imprinting center (AS-IC). Three founders were used interchangeably. (J:270068)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rr70 Mutation: 0 strains or lines available

References

• Original: J:270068 Lewis MW, et al., A mouse model of Angelman syndrome imprinting defects. Hum Mol Genet. 2019 Jan 15;28(2):220-229
• All: 1 reference(s)