Fancm^em1Jcs
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fancm^em1Jcs
• Name: Fanconi anemia, complementation group M; endonuclease-mediated mutation 1, John C Schimenti
• MGI ID: MGI:6306300
• Synonyms: Fancm^-, Fancm^em1/Jcs
• Gene: Fancm Location: Chr12:65122377-65178832 bp, + strand Genetic Position: Chr12, 27.21 cM
• Alliance: Fancm^em1Jcs page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A 7 bp deletion (CCCGTGC) was created in the coding region of exon 1 using an sgRNA (targeting CCAGCTGGTAGTCGCGCACGG) with CRISPR/Cas9 technology. This creates a frameshift and premature stop codon (p.P78Afs*56). (J:274368)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fancm Mutation: 120 strains or lines available

References

• Original: J:274368 McNairn AJ, et al., Female-biased embryonic death from inflammation induced by genomic instability. Nature. 2019 Mar;567(7746):105-108
• All: 2 reference(s)