Cers5em2Btlr
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cers5em2Btlr |
| Name: |
ceramide synthase 5; endonuclease-mediated mutation 2, Bruce Beutler |
| MGI ID: |
MGI:6303837 |
| Gene: |
Cers5 Location: Chr15:99633473-99670396 bp, - strand Genetic Position: Chr15, 56.13 cM
|
| Alliance: |
Cers5em2Btlr page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The CRISPR/Cas9 system and sgRNA 5'-TGTTACTAAGGTAAGTGAGC-3' was used to generate the mice. The CRISPR/Cas9 system generated a 20-base pair deletion TCATCCGGCTCACTTACCTT at g.21297_21278 (NC_000081.6). The mutation is predicted to destroy the exon 2 donor splice site, resulting in the use of an adjacent cryptic site. The resulting transcript would have a 47-bp insertion causing a frame-shifted protein product beginning after amino acid 100 of the protein and premature termination after the inclusion of seven aberrant amino acids.
(J:274568)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Cers5 Mutation: |
35 strains or lines available
|
|
| Original: |
J:274568 Choi JH, et al., LMBR1L regulates lymphopoiesis through Wnt/beta-catenin signaling. Science. 2019 May 10;364(6440) |
| All: |
1 reference(s) |
|