About   Help   FAQ
Cers5em2Btlr
Endonuclease-mediated Allele Detail
Summary
Symbol: Cers5em2Btlr
Name: ceramide synthase 5; endonuclease-mediated mutation 2, Bruce Beutler
MGI ID: MGI:6303837
Gene: Cers5  Location: Chr15:99633473-99670396 bp, - strand  Genetic Position: Chr15, 56.13 cM
Alliance: Cers5em2Btlr page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe CRISPR/Cas9 system and sgRNA 5'-TGTTACTAAGGTAAGTGAGC-3' was used to generate the mice. The CRISPR/Cas9 system generated a 20-base pair deletion TCATCCGGCTCACTTACCTT at g.21297_21278 (NC_000081.6). The mutation is predicted to destroy the exon 2 donor splice site, resulting in the use of an adjacent cryptic site. The resulting transcript would have a 47-bp insertion causing a frame-shifted protein product beginning after amino acid 100 of the protein and premature termination after the inclusion of seven aberrant amino acids. (J:274568)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cers5 Mutation:  35 strains or lines available
References
Original:  J:274568 Choi JH, et al., LMBR1L regulates lymphopoiesis through Wnt/beta-catenin signaling. Science. 2019 May 10;364(6440)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory