Cfap418^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap418^em1(IMPC)J
• Name: cilia and flagella associated protein 418; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294893
• Gene: Cfap418 Location: Chr4:10874498-10899425 bp, + strand Genetic Position: Chr4, 4.85 cM
• Alliance: Cfap418^em1(IMPC)J page
• IMPC: Cfap418 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGCTGTCACTCTAGCAGT and TGAGGAGTACAGGTAAAGAA, which resulted in a 505 bp deletion beginning at Chromosome 4 position 10,879,214 bp and ending after 10,879,718 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001279296 (exon 2) and 417 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 53 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cfap418 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)