Noxred1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Noxred1em1(IMPC)J |
Name: |
NADP+ dependent oxidoreductase domain containing 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6294782 |
Gene: |
Noxred1 Location: Chr12:87267897-87285375 bp, - strand Genetic Position: Chr12, 41.42 cM, cytoband E
|
Alliance: |
Noxred1em1(IMPC)J page
|
IMPC: |
Noxred1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGCATGCCTAACTCCAAG and AGGAAGCAGCTTAAGTCACG, which resulted in a 337 bp deletion beginning at Chromosome 12 position 87,224,804 bp and ending after 87,225,140 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000114055 (exon 5) and 156 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 119.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|