Zfp786em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Zfp786em1(IMPC)J |
Name: |
zinc finger protein 786; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6294143 |
Gene: |
Zfp786 Location: Chr6:47796200-47807801 bp, - strand Genetic Position: Chr6, 22.94 cM
|
Alliance: |
Zfp786em1(IMPC)J page
|
IMPC: |
Zfp786 gene page |
|
Strain of Origin: |
Not Specified
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCACCTCTAAGGACAAAC and GTAATTTGAGACTCACAGAG, which resulted in a 404 bp deletion beginning at Chromosome 6 position 47,826,784 bp and ending after 47,827,187 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001268428 (exon 2) and 277 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 8 amino acids later. There is a single bp (A) insertion at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|