Col6a3^em1Wklm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Col6a3^em1Wklm
• Name: collagen, type VI, alpha 3; endonuclease-mediated mutation 1, Juliane Winkelmann
• MGI ID: MGI:6285481
• Synonyms: Col6a3^CTT
• Gene: Col6a3 Location: Chr1:90694582-90771710 bp, - strand Genetic Position: Chr1, 45.53 cM
• Alliance: Col6a3^em1Wklm page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:353033
• Parent Cell Line: v6.5 (ES Cell)
• Strain of Origin: (C57BL/6 x 129S4/SvJae)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: A premature stop codon was inserted into exon 36 generating a C-terminal truncation. CAACTGTCCGCGG was deleted and replaced by CCCACAAAGAGAGAGAGTCA via CRISPR/Cas9 technology, yielding a frame-shift and premature stop codon in exon 36. In the predicted protein product, the 15 amino acid sequence NCPRGARVAVVTYNN is replaced by PQRERVRCPRGCGHL followed by the stop codon, resulting in severe disruption of the C1 domain (out of 180 amino acids, 36 intact, 15 altered, and 129 missing) and complete absence of the C2-C5 domains. (J:353033)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Col6a3 Mutation: 169 strains or lines available

References

• Original: J:353033 Lam DD, et al., Collagen VI Regulates Motor Circuit Plasticity and Motor Performance by Cannabinoid Modulation. J Neurosci. 2022 Feb 23;42(8):1557-1573
• All: 1 reference(s)