About   Help   FAQ
Col6a3em1Wklm
Endonuclease-mediated Allele Detail
Summary
Symbol: Col6a3em1Wklm
Name: collagen, type VI, alpha 3; endonuclease-mediated mutation 1, Juliane Winkelmann
MGI ID: MGI:6285481
Synonyms: Col6a3CTT
Gene: Col6a3  Location: Chr1:90694582-90771710 bp, - strand  Genetic Position: Chr1, 45.53 cM
Alliance: Col6a3em1Wklm page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:353033
Parent Cell Line:  v6.5 (ES Cell)
Strain of Origin:  (C57BL/6 x 129S4/SvJae)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsA premature stop codon was inserted into exon 36 generating a C-terminal truncation. CAACTGTCCGCGG was deleted and replaced by CCCACAAAGAGAGAGAGTCA via CRISPR/Cas9 technology, yielding a frame-shift and premature stop codon in exon 36. In the predicted protein product, the 15 amino acid sequence NCPRGARVAVVTYNN is replaced by PQRERVRCPRGCGHL followed by the stop codon, resulting in severe disruption of the C1 domain (out of 180 amino acids, 36 intact, 15 altered, and 129 missing) and complete absence of the C2-C5 domains. (J:353033)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Col6a3 Mutation:  169 strains or lines available
References
Original:  J:353033 Lam DD, et al., Collagen VI Regulates Motor Circuit Plasticity and Motor Performance by Cannabinoid Modulation. J Neurosci. 2022 Feb 23;42(8):1557-1573
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory