Tifa^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tifa^em1(IMPC)J
• Name: TRAF-interacting protein with forkhead-associated domain; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284822
• Gene: Tifa Location: Chr3:127582524-127592043 bp, + strand Genetic Position: Chr3, 56.54 cM
• Alliance: Tifa^em1(IMPC)J page
• IMPC: Tifa gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCAGTCTTATAATGTGGA and GACTGGTGATCTGCAGCAAG, which resulted in a 2018 bp deletion beginning at Chromosome 3 position 127,796,415 bp and ending after 127,798,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001352154 (exon 3) and 197 bp of flanking intronic sequence including the splice acceptor and start of translation and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tifa Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)