Krtcap2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Krtcap2em1(IMPC)J |
Name: |
keratinocyte associated protein 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6284515 |
Gene: |
Krtcap2 Location: Chr3:89153201-89157036 bp, + strand Genetic Position: Chr3, 39.03 cM, cytoband F2
|
Alliance: |
Krtcap2em1(IMPC)J page
|
IMPC: |
Krtcap2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCGACCTCCAGGAACCACC and GAAGGGACTATTAACACCAT, which resulted in a 2793 bp deletion beginning at Chromosome 3 position 89,246,442 bp and ending after 89,249,234 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309950 and ENSMUSE00000310326 (exon 2 and 4) and 2507 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 43 amino acids later. There is a 30 bp insertion at the deletion site (TAATAGTCCCTTCCCTTCCCACCATATGCC)
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|